Wednesday, July 31, 2019
Is Good spech
This can be seen in many areas, from the struggle for women's rights, to the oppressive e racism that caused the great Civil Right's Movement. Throughout these hard times, there have always been those who have stood up and fought for what they believed in.One of these great people woo old have to be Doctor Martin Luther King Jar. Despite the crippling racism, and the horrible treatment he faced as an African American, King stood tall and strong, leading the African Americans in the fight t gag insist racism. Time and time again he stood before crowds, protesting against the injustice they f aced. Before one of these large crowds, he gave one of the most memorable speeches in American whist ROR; his ââ¬Å"I Have a Dreamâ⬠speech. In his speech, he stressed how, despite all the hatred and injustice of the time, he still had a dream.His dream, across the nation, all would put aside the past and become united. His dream across the nation, men and women would not be judged by the co lor of their skin, b UT by the content of their character. His dream, despite the disdain and judgment of the time, in the futz ere across the nation everybody would be able to join hands and become brother and sister, united . His speech became an outstanding inspiration, and motivated the people to see each other as equal s, thus ending the Civil Rights Movement. King stood against injustice, and for the belief all are equals.However, in toad Yes society this still does not ring true. Does living on the street, living paycheck to paycheck, or begging for food and change seem equal to living in mansions, swimming in grand pools, and feasts Eng every day? Injustice Cushman 2 in today's society being no longer found in violence and insults, but found in if nuances. Entertainers earn far more than public servants, creating a huge inequality gap. Those who sacrifice so much, and devote themselves to doing the right thing, they struggle more than those who o focus inwards, and devote th emselves, to themselves.Statistically speaking, 23% of the homeless population is made up Of veterans, this being between 1 30,000 and 200,000 veterans without a home o n any given night. These men and women devoted their lives to America, to protecting every single India viaduct's freedom in this nation. What greater sacrifice can there be? Additionally, a recent example of annual military pay came in at $38,734. Compare this to a football athlete in the NFG who makes $1. 9 m lion annually. America is paying a man with a football jersey and helmet more than a man in a comb t helmet and uniform.America has promoted paying a man more to catch a ball, then a man who is putting his life on the line for his country. How immoral does this seem? Furthermore, the base of all if notion in society has to be education. Who gives education? Teachers do. Elementary teachers, who have given the foundation of success, earn an annual average of $56,130 nationally. Actors of the likes of R Bert Dow ney Jar. And Changing Datum however, make a net worth of 550 million. A pretty boy actor on a screen will make hat much more money than a teacher with a white board.Where would the j justice be in this? Men and women dedicated to the betterment of this nation are making very Ii title money, especially compared to those who simply dedicate themselves to a franchise or producer. Public servants such as teachers, law enforcement officers, and military personnel e ran substantially less income than entertainers. Thus, this becomes my dream. My dream features America proportioning, giving more money to those who sacrifice the most, because they truly have e earned it.My dream, those ho are putting their lives down on the frontline for their brothers and sister s will earn the same as those putting their names onto a movie contract. My dream, teachers, giving t he most valuable tool to our community, education, will earn the same as a man running into an end z one with a ball in his hands . My dream, public servants who serve as the basic function for this who ole nation, will earn the Cushman 3 same income as those who solely entertain this nation.
Tuesday, July 30, 2019
Essay on Reality Shows Should Not Be Banned
Reality television has become very popular over the past decade with shows such as ââ¬Å"Survivorâ⬠, ââ¬Å"Big Brotherâ⬠and ââ¬Å"The Apprenticeâ⬠attracting big audiences and making a lot of money for broadcasters worldwide. A definition of reality television is quite difficult but at its most basic it means programmes that show things really taking place, rather than drama or comedy that follows a script. Typically reality TV involves a group of people who are not trained actors being filmed in unusual situations over a period of time.Sport and news programmes are not considered reality TV. Documentaries that explore aspects of society are a grey area, with some closer to news reporting and others blurring into reality TV because they set up situations which did not already exist. Recently celebrity versions of reality shows have made definition even harder, because they show the private lives of professional singers, actors, sportspeople, etc. as they cope with new situations.Reality TV is often a hot topic as proponents believe it paints an unrealistic and inappropriate portrait and is therefore bad for our society and the children that make up the majority of the audience. They call for a cut in the number of hours given over to reality programmes, or even to ban them completely. Opponents meanwhile maintain that people should be allowed to watch what they like, and that reality programmes make good TV, as shown by consistently high viewer figures.Reality TV is dishonest ââ¬â it pretends to show ââ¬Å"realityâ⬠but it actually distorts the truth to suit the programme makers. The shows are not really ââ¬Å"realâ⬠ââ¬â they are carefully cast to get a mix of ââ¬Å"charactersâ⬠who are not at all typical. Mostly they show a bunch of young, good-looking self-publicists, who will do anything to get on TV. Usually the programme makers try to ensure excitement by picking people who are likely to clash with each other.T hey then place them in unnatural situations, such as the Big Brother house or the Survivor island, and give them strange challenges in order to provoke them into behaving oddly. In The Bachelor, where a group of women compete for the affections of an eligible male, the ââ¬Ëintimate datesââ¬â¢ they go on are filmed in front of any number of camera; that is not reality (Poniewozik, 2003).Finally the makers film their victims for hundreds of hours from all angles, but only show the most dramatic parts. Selective editing may be used to create ââ¬Å"storylinesâ⬠and so further manipulate the truth of what happened.
Tattoos on the Heart: Success
Gregory Boyle begins chapter eight: ââ¬Å"Success with a few questions that seem so simplistic at first glance. What is success and what is failure? What is good and what is bad? Setback or progress? â⬠(Boyle 167). Taking a few moments to process these questions, one realizes that the question is quite complex and difficult. Success has such a subjective definition that it can only be defined by the one who answers the question of ââ¬Å"what is success to you? â⬠and has no universal definition. Specifically with gang members, success in the context of their lives is about personal growth and less about tangible results. Do not be conformed to this world, but be transformed by the renewal of your mind, that by testing you may discern what is the will of God, what is good and acceptable and perfectâ⬠(Biblegateway). Their lives have endured much turmoil and through experiences they find what is good and acceptable and perfect to themselves. Individuals may have their own views on success and failures, and these views may be similar or vastly different. Success for anyone, particularly the gang members, is doing the best one can in any given situation. This may be forgiving the killer of your son or deciding to discontinue participation in gang activities. Although defining success proves to be elusive there are many forms of success that should be embraced with open arms. From personal experiences my definition of success has differed greatly from time to time. This is similar to how success of a gang member is dependent on where they currently happen to be in their lives. On one day success was defined as getting out of bed and staying awake for me, just as how a gang member thinking about changing his life. Getting out of bed is quite an insignificant act on its own, but in that period of my life I was not able to function and this was considered to be quite successful. A gang member simply thinking about his life may not be a significant act on its own, but when he has dwelled in chaos all of his life, this thought is like a shining light piercing the clouds that hinder him. All of a sudden these insignificant acts take on the form of complete success. On another day success was thriving and excelling in college. Getting out of bed and staying awake was success for me when I was in the midst of a depressive episode, and now success is fully applying myself in college courses. Simply getting up out of bed compared to excelling in college, one can recognize that these actions differ greatly, but given the circumstances, are both successes. This same philosophy can and ought to be applied to former and current gang members. Consider Stan, he is the co-founder of the Crips street gang and is on death-row for past crimes he has been convicted of. Stan is also the epitome of success. Father Gregory Boyle has said that Stan is ââ¬Å"not the person he was 27 years ago, and if he is granted clemency, his impact on kids, who plan their funerals and not their futures, will continueâ⬠(Allen). He has transcended from his previous life and become a resource against his original foundation of gang life. When we acknowledge the past decisions Stan has made and compare those decisions to where he is now, the amount of success found in that comparison is absolutely immense. In any circumstance speaking out against the negative consequences of gang banging is a feat on its own, but in the context of Stanââ¬â¢s life he lived and breathed gang life. Now he is speaking out against gang violence and this is what makes Stan the epitome of success. From where he was to where he is, he is a changed man. Success is like the silver lining of every cloud. Even in the case of a grieving mother screaming and wailing out of agony when hearing her son has died, success can be found. ââ¬Å"All the homies gathered together plotting vengeanceâ⬠¦ I lean over and whisper to her that Victor is dead. And this time the homies are there to hearâ⬠¦ Screams that curdle your insides. The homies didnââ¬â¢t do anything that nightâ⬠(Boyle 170). No parent should need to bury their children and this enunciation of pain along with proximity to the homies was enough to alter their planned vengeance. Just like the questions Boyle proposed at the beginning of the chapter; there was difficulty in making a connection between the death of a child and the idea of success. With further evaluation it became evident that success was not in what happened, but what did not happen. It is safe to assume that the majority of people would consider the death of a child a failure, but the majority of people fail to look past this isolated event. The gang members were ready to claim vengeance as theirs and continue the cycle of pain, death, and violence. But because of a tragedy stricken mother the cycle was broken right then and there. The breaking of this negative downward spiral is a success in its own right. Another mother would not need to receive the news of her son being shot, another confused gang member would not end up in the penitentiary system, and another child would not be left fatherless. Just as every cloud has its silver lining; unfathomable sadness has positive aspects within itself. Mark Torres, S. J. , beloved spiritual guide at Homeboy Industries, says, ââ¬Å"We see in the homies what they donââ¬â¢t see in themselves, until they doâ⬠(Boyle 178). The gang members hold within themselves a poisonous shame that corrupts their sense of self. Without a sense of self it is tremendously difficult to move forward and people tend to stay stuck in what they know. Homeboy Industries nurtures these members and provides them with the support and stability to shed that poisonous shame, which allows them to find their sense of self and succeed. Albert Ortega was recently released from prison and says, ââ¬Å"I wanted a new way of life. â⬠(Jordan) This statement alone is success. Here is a man wanting to change his life for the better and taking actions to acquire that change. In the context of Albertââ¬â¢s life he was a past criminal and the fact that he wanted better for himself is a major step and major success. Not only did he want more, but he took the initiative and seized the opportunity Homeboy Industries offered him. Just as clay can take many forms, so can success. Whether Albert takes the steps to improve his life through education or a grieving motherââ¬â¢s scream sways gang members from pursuing vengeance; these are both successes in differing forms. As much as how success can be displayed differently through actions; our own views of these actions influence what form of success we may come to the conclusion of. Homeboy Industries is consistently looking for funders to provide resources and help the nonprofit flourish, but funders tend to fund success that can be measured in quantitative values. What have you done and why should we, the funders, pool our resources into your organization? This is one way to view success, but this view is narrow sighted and fails to see so much more of the bigger picture. This perspective fails to see all the men and women deciding enough is enough and taking steps to better themselves, or the former gang member who wants to better his community. These successes may not be able to be tallied up on paper, but are successes in their own respective form. These people are doing the best they can and bettering themselves given the hand dealt to them. Success has no universal definition and cannot be limited to measurable values. Particularly funders, but everyone should not limit their field of vision by only observing this miniscule idea of success. On Friday $60,000 to $70,000 worth of equipment was stolen from Homeboy Industries storage, but will not cripple the 3-year-old program. All this burglary did is reverted it back to an older form of graffiti removalââ¬âbuckets and rollers (Mccartney). The homies working in a graffiti removal unit were utterly disrespected by others and they simply decide to continue doing their jobââ¬âgraffiti removal. ââ¬Å"The first step toward success is taken when you refuse to be a captive of the environment in which you first find yourselfâ⬠(Mark Caine). These former gang members were not affected or provoked by these acts. They were not held captive of their environment, accepted what had happened, and moved forward. Similarly to how success can be displayed and viewed differently, sometimes the simplest acts are the most significant. A typical person losing $70,000 worth of equipment would go on an absolute rampage, but these former gang members faced adversity with resilience and simply picked up where they had to. There is a sense of awe in how such a simple act portrays so much success. The act of continuing to move forward and denying oneself of ruminating is simplistic, but powerful. Especially given the background of these men and women, this act of continuing just shows how successful they are and how successful they will continue to be. Although success takes on many forms and depends on our own personal views of what is considered successful, the real success is ones acceptance of each otherââ¬â¢s actions. From my experiences of getting off of the couch to a crew of former gang members facing adversity with resilience; the idea of success shrouds itself within our own perceptions and prejudices. Just like the saying, ââ¬Å"beauty is in the eye of the beholder,â⬠so is success. Living in this world we ought to strive for the same level of objectivity that God projects when looking upon us. We cast aside our own perceptions and inherit the perception of God where we can see the whole picture, not just the portion we prefer. After taking a moment to analyze the questions posed at the beginning of chapter eight, it is clear that these questions demonstrate and stress the subjective aspects of success. When Gregory Boyle included the chapter based on success, he wanted us to get a sample of the different forms that success may present itself in. Regardless of the act that has occurred, we ought to welcome success in its many forms. Success may present itself in the form of a baby taking her first steps or a gang member acknowledging she has a problem. These scenarios may seem different at a first glance, but in the end, all successes are welcomed and celebrated in their own forms.
Monday, July 29, 2019
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words
Gene Analysis - Essay Example Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integra tes in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis. Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base. GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3' Results and discussion: The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence. FIG 1: BLAST results >ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J Length=28591323 Features in this part of subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/Plus Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217 Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104 Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.Similarly BLAT analysis retrieves same gene against the query of given sequence.
Sunday, July 28, 2019
Relationship between the business strategy and an entity's Essay
Relationship between the business strategy and an entity's organizational culture regarding staffing decisions - Essay Example Most significantly, organizational culture remains a crucial component in any firm. Every organization does possess a clear unique personality of the staff members. For the purpose of achievement of clear objectives and working in unity among the team members, i9t is essential to have one mind-set when it comes to the organizational culture. A unit that is divided mentally and ideological wise cannot achieve its targeted goals. Organizational culture comprises of a number of factors such as innovativeness, where the team leaders challenge their staff members to take risks in all situations.an organizational culture also establish the level of precision expected from each employee. Additionally, it emphasizes on respect and dignity to employees, teamwork, aggressiveness, and stability of tenure (Zheng, Yang, & McLean, 2010). From the outlook of the role of the organizational culture in any firm, it is very difficult for the two components to work without interlinking. Primarily, for the set goals to reach a level of success, the team implementing the same must be in possession of the appropriate spirit and skills. The organization must create a conducive atmosphere for the achievement of the strategies. Concisely, one cannot focus on achievement of business strategies, and at the same time disregarding the environment, that defines the culture. Therefore, both components have to be put into consideration. Zheng, W., Yang, B., & McLean, G. N. (2010). Linking organizational culture, structure, strategy, and organizational effectiveness: Mediating role of knowledge management. Journal of Business Research, 63, 763ââ¬â771.
Saturday, July 27, 2019
Article response paper Example | Topics and Well Written Essays - 750 words - 4
Response paper - Article Example The article also points out why LA can be regarded as a crucial phenomenon to be used while teaching some issues related to language. The article also focuses on the theoretical perspectives, which guide literacy autobiography, and how useful they can be termed to be with regard to literary autobiography. The article outlines that L1 and W1 should be included in the L2 classroom (Steinman, 2007). Personal observation After reading the article, I gained outstanding knowledge regarding literary autobiography. The article is helpful in a number of ways, and the immense information contained in the article forms the basis for a deep understanding of what languages entail. From the article, I have managed to learn that there are various theoretical frameworks that support LA. I have learnt that certain writing conventions can be regarded as significantly crucial. These writing conventions include affective, textual, cognitive, contextual, as well as political. Language also plays a crucia l role in the development of thought. LA is vital to learning for teachers, as well as multilingual students. The L1 writing skills held by writers can be regarded as crucial since writers tend to bring such skills when they take part in L2 writing. The article outlines the crucial role played by information regarding early literacy. As stated in the article, information about early literacy determines the factors that have an impact on the academic writing skills of students (Steinman, 2007). The article outlines that the classroom can be regarded as a place where trans-cultural dialogue takes place. This means that students from diverse cultural backgrounds interact and the cultural beliefs of each student have to be respected. It is worth noting that the article points out the little advocacy with regard to the inclusion of L1 in institutions of higher learning such as universities and colleges. The article also points out levels of change, which tend to be three. These levels in clude change of practice, material and beliefs. Numerous approaches prove to be helpful in the literature and research of Literacy autobiography. Some of the central approaches encompass socio-cultural theory, communities if practice, multiliteracies, as well as contrastive rhetoric. LA is instrumental in examining how writing practices, as well as writing, differ between cultures. Based on multiliteracy, meaning should be derived from all forms of language used in teaching. The article explores various ways in which students from various backgrounds tend to be welcomed in a community of practice, which consists of various languages and students from diverse backgrounds. Writing is crucial to the developing of collaborative learning, as well as value and thought (Steinman, 2007). Excerpts ââ¬Å"I have since been taking part in studying, talking, and thinking about contrastive rhetoric, which refers to the study of writing values and writing conventions, as well as how these tend to vary in different culturesâ⬠(Steinman 2007, p.564). ââ¬Å" I discovered the implications and significance of writing conventions such as political, affective, cognitive, contextual, and textual. Consequently, I started rethinking what I expected second language students in my class to bring out appropriately and what they could not articulate with a lot of easeâ⬠(Steinman 2007, p.564). The reason for choosing the above excerpts is because they fundamentally address the
Friday, July 26, 2019
The impact of subculture on consumer behavior Research Paper
The impact of subculture on consumer behavior - Research Paper Example The paper discusses the different types of subcultures. The age and the ethnic subculture are discussed in detail. Due to the varied nature of consumer preferences that have emerged as a consequence of subcultures, the managers have to spend time and resources in construing a marketing mix that caters maximally to the diverse needs of consumers. A business culture is defined as the set of shared values, perceptions, attitudes and the philosophies of an organization. These values are instilled into the employees through the mission statement of the organization. The mainstream culture of the organization is reflected in its subcultures. Consumption helps to construct an identity for the consumer (Saren, 2007). Subculture refers to the pockets or segments of culture that show variations in attitudes, customs, values and norms as a result of geographical distances or the departmental aims or job requirements of an organization (BusinessDictionary.com, 2010). The Consumer Culture Theory helps to explain the relationships between the consumers, their consumption practices and their socio-cultural systems and analyzes cultural meaning systems (Arnould & Thompson, 2005). Subcultures operate within the broader perspective of the professional culture; yet, subcultures are different from the main culture since the people forming the subculture have some degree of difference in their values and behaviors. There are various types of subcultures present in an organization. Some subcultures have a major impact on the organizational policy, whereas others are barely conspicuous and unimportant. This paper attempts to explore the impact subculture has on consumer behavior. Gattorna (2009) observes that the dynamic alignment concept involves the alignment and integration of four elements: the market place, the responses to consumer demands, the internal cultural
Thursday, July 25, 2019
Morrisons Supermarkets Plc Assignment Example | Topics and Well Written Essays - 1500 words
Morrisons Supermarkets Plc - Assignment Example It is mainly to decrease the level of obesity among the citizens of UK. Due to which, the government of UK is presenting huge number of campaigns so as to increase the level of awareness over obesity. Side by side, they are also presenting the details or extent of the nutrients that might help an individual to attain a healthy and fit body. So, all the supermarkets are trying to present or display the products including the exact mixture of nutrients to help the customers, in reducing obesity. Side by side, they are also presenting the GDA for men and women so as to maintain a healthy body. The prime objective of such strategy is to retain the older customers and to attract the new ones so as to remain competitive in the market. Otherwise, the supermarkets like Morrisonââ¬â¢s might lose its range of customers and reputation in the market among others. Economic- inflation offered high impact over the prices of the products of the supermarkets and many other retail organizations. Du e to which, the supermarket owners had to present products with lower prices so as to retain its brand image and range of customers. Side by side, the decrease in the rate of the disposable income also created a substantial impact over the buying behaviour of the customers. Therefore, in order to fulfil their requirements and demands, the supermarket players had to present wide range of product lines. It is done, so as to match their incomes, living standards and life styles. Therefore, only due to the presence of varied types of products, the supermarkets like Morrisonââ¬â¢s became successful in retaining its range of customers and profit margin in such challenging scenario... This paper stresses that according to the high brand image and recognition in the market of UK, the total sale and revenue of the Morrison Supermarket is increasing rapidly. Along with this, due to the presence of varied types of products, customers of varied income groups and living standards might avail facility to purchase the products. Side by side, all the customers might very easily avail the facility of discounts on the products presented by Morrison Supermarket. So, it might be depicted that Morrison attains a very reputed position in the market as compared to others. Side by side, as it is widely expanding, its brand value and equity is also increasing significantly in the market among others. The author of the essay declares that In order to increase the popularity and brand image of Morrison supermarket, it is essential to implement an online site. This might prove effective in enhancing its total sales and revenues as well. Side by side, the organization might also try to recruit trained staffs within the organization so as assist the customers at the time of purchasing any products. This might prove effective in increasing its total sale and brand value as well. This report makes a conclusion that it might be stated that the brand value and recognition of the organization of Morrison might be enhanced by increasing its variety of products. Along with this, if the range of discounts presented over the products might be increased, then the range of customers may also be increased.
Abrahams Promise by Michael Wyschogrod Essay Example | Topics and Well Written Essays - 2000 words
Abrahams Promise by Michael Wyschogrod - Essay Example This book is also an attempt by the author to bring Jews and Christians together and this he has done by raising logical questions that reflect upon their profound sameness rather than their deep differences. Kendall has not argued about the similarities or differences that Christians eagerly claim their Jewish faith roots, but he has endeavored a reason to consider that what escorts Jews to understand Christian theological concepts and why there is a need for the Christians to learn about treating minorities with dignity. This book reveals how the gap that has built over centuries should be bridged in order to gain an in depth understanding of both communities. Declaring the reason behind Gods love, Kendall points out what God expect from humans is the divine acknowledgement of their relation of their bodies with their souls, and since God believes in a free love, he has never limited humans. As a matter of fact, God himself is never limited to any particular genealogy. He had always possessed the right not to select Abrahams descendants as chosen ones or to replace his chosen ones with any other people not chosen. Kendall portrays Abraham, Issac and Jacobs God and presents before the readers a notion that God selected Israel as he loved Abraham descendants and chose them from among all groups. According to Kendall ââ¬Å"God wanted a people who could not leave himâ⬠(Kendall, 2004: 50). For this reason Kendall points out that God favored and loved Israel in the same manner as a man loves a woman or his wife. What Kendall wants the reader to contemplate upon is the question he addresses that what caused God to choose a biological family rather than a community of faith (ibid). Wyschogrods perspective of the Jewish community is an answer to the above question, that suggests that God chose community of family is that of Abrahams descendants that elucidates Gods school of thought to
Wednesday, July 24, 2019
SPSS Analysis & Methodology Section Term Paper Example | Topics and Well Written Essays - 3500 words
SPSS Analysis & Methodology Section - Term Paper Example as an Internet marketing tool by the companies. â⬠¢ To examine the evidence about the benefits of using social networking websites as communication tool. Details of the methodological implications will be highlighted in the following sections. 1.2 Research Approach Saunders, Lewis & Thornhil (2007 & 2009) pointed out that researchers should select any one of the research approach from available approaches such as, 1- Correlation Study- understanding the relationship between variables is the key aim in such kind of studies and 2- Causal Study- finding out the reasons behind the variation in the behaviour of variables is the key reason behind such kind of research approach. As the researcher is trying to understand the role of social networking websites such as Facebook and twitter on increasing effectiveness of Internet marketing tool for companies hence the researcher will use correlation approach to find out what is the relationship between effectiveness of Internet marketing to ol and social networking website penetration. ... 1.3 Research Strategy Creswell (2009) stated that there can be three types of research strategy for researchers such as, 1- Quantitative research strategy- gathering primary data by using open ended and preferably close ended questionnaire or secondary data with the help of literature review, case study etc and then analyze the data by using mathematical and statistical operators, 2- Qualitative approach- gathering data from secondary sources or open ended questionnaire based interview, observation, ethnography and then analyzed data in non-numeric manner, 3- Mixed strategy- combination of both qualitative and quantitative research approach. Saunders, Lewis & Thornhil (2007 & 2009) argued that quantitative research strategy works well for establishing new theory or explaining a social phenomenon but the research strategy works poorly for measuring the relationship variables in absolute manner. On the other hand, Bryman & Bell (2003) also found that quantitative research can be used f or finding the relationship between variables in definite manner. As the researcher has also planned to understand the role of social networking websites in digital marketing which is a definite phenomenon hence the researcher will use quantitative research strategy in the study. 2.3 Unit of analysis and Study setting Robson (2011) stated that while conducting quantitative data analysis, researchers need to set the confidence interval high enough to get correct research findings. Saunders, Lewis & Thornhil (2009) suggested that 95% confidence level with significance of 0.05 can be used in case of academic research. Hence, the researcher will also use the 95%
Tuesday, July 23, 2019
Business Law Essay Example | Topics and Well Written Essays - 1750 words - 1
Business Law - Essay Example This also helps to provide a clear indication about the intention or willingness of acceptance of certain rules and regulations by both the parties through a mutual understanding. If any misinterpretation occurs within the agreement then it might hamper both the parties resulting in uncertainty and misinterpretation of the law3. In addition to agreement, capacity is also the other significant element of a contract. It is referred as the capability of both the parties to come into a legally requisite contract. Other than this, intention of both the parties also offers a considerable role in the contract. This part mainly describes the key purposes of both the parties present within the contract5. Formalities are another considerable component of a contract which mainly describes that a contract may be created either in written or in oral form. Besides, the written form is more efficient as it helps to reduce the activities of frauds5. This can be reduced only when both the parties wit hin a contract are mutually in accord with oneââ¬âanother leading to concurrence of will. ... All the above constituents are equally important for making a contract legitimate and breach of one of these factors may result in a void agreement5. Application of the Law to the Case The case study presented in the assignment does not follow all the elements of a contract in an effective way. The case study mainly highlights a contract of selling a refurbished bicycle within Australia and so it needs to conform to various rules and regulations of Australian Contract Law. It was a transpiring business understanding between a university student named Peter and owner of ââ¬Ëtourbikesââ¬â¢, Sally. Both the parties were well capable to enter into a mutual agreement. Besides, the intention of both the parties was entirely different from one another. The purpose of Peter was to purchase a bicycle in order to retain the part-time job as a courier, which might prove highly beneficial for him to pay for the fees of his university. In addition, the main consideration of Peter was that h e wished to purchase a bicycle within an amount of AU$5000. He desired to purchase a bicycle model named as Cadel Evans ââ¬ËGFââ¬â¢ only to fulfill his inclinations whereas Sallyââ¬â¢s key perception was to sell off the bicycle at any cost. On the other hand, the intention of Sally was to sell the bike in order to pay off the amount taken as a credit. In the provided scenario, a proper offer as well as acceptance was not made from either of the interested parties i.e. Peter or Burt. Moreover, there was no proper agreement reached between the interested parties and the seller Sally. Sally also did not make a proper communication to Peter before delivering the bike to his house, which depicts certain lack of consideration on behalf of Sally as Peter did
Monday, July 22, 2019
Dr. Jekyll and Hyde analysis Essay Example for Free
Dr. Jekyll and Hyde analysis Essay The only reason he would be acting like this, even though Jekyll is ofa higher class, he wants to be associated with Hyde for a reason he does not want his friends to know. As if Jekyll was not acting odd enough already he defends Hyde no matter he does, Jekyll always attempts to justify Hydes actions. Also he has listed everything in his will to Mr. Hyde for unknown reasons at the time only raising more curiosity from the charcters in the book as well as the reader. Throughout known history London has been seen as a symbol of wealth and prosparity, but Stevenson shows the other side. And if any time he dozed over, it was but to see it glide more stealthily, even to dizziness, through wider labyrinths of lamp-lighed city, and at every street corner(Stevenson 8). The city of London is drastically different from peoples general idea of that city. Most people think of all the hisorical landmarks and areas, not the poorer sections that Stevenson tends to focus on. He may be doing this to help sumbliminatley further the idea of the duality in people. Maybe trying to convince the people that if a city can be split in its personality so can the people of this world. Earlier the Ying-Yang was compared to Jekyll and Hyde and it was extremly well demonstraighted towards the end of this book when it is revealed to the reader that Jekyll revealed he wanted to be Hyde. The power of volventary chance be forfieted, and the character of Edward Hyde become irrevocably mine0ekyll/Hyde 48). Jekyll had always wanted to be a rulebreaker like Hyde, growing up in wealthy family he had a reason and a need to rebel against what was exspected of him. Jekyll seemed to want to live on the other side of life to experience all aspects of what life at the ime had to offer. It is Just a natural instinct of some people to rebel out of not being satisfyed. Or, in Dr. Jekylls case wanting to experence the other side in this world. Stevenson repeatedly brings up this idea throughout the text, while never coming out and saying it. Stenson is able to bring this idea up in every readers mind multiple times. This story was also possibly wrote to show everyone that has read it that nobody is purely good or evil, there is no black or white, that everyone no matter what they do is Just a shade of gray. Dr. Jekyll and Hyde analysis By zooglicious
Sunday, July 21, 2019
New Fitness Trends And Crazes Physical Education Essay
New Fitness Trends And Crazes Physical Education Essay The fitness industry is constantly diversifying with new fitness trends and crazes. The most recent trend is Zumba. Zumba is being marketed as a new exciting way to stay active and healthy. It boasts of its fun aspect and its ability to bring people together to get fit and have fun at the same time. Founder, Alberto Perez a Miami based dancer once forgot his traditional music to a fitness class he was leading and instead used some Latin music tapes. He delivered the session letting the music lead and guide him like in a club. The participants loved it and so Zumba was born. Now, more than 3 million DVDs have been sold in over 30 countries. In a recent poll, Zumba ranked 9th for international fitness trends in the year 2012 (Thompson, 2012). Zumba currently has well over 9,000 instructors worldwide and on October 15, 2007 Zumba was showcased on the Today Show. In October 2008, worldwide Virgin Active sport centres started proposing Zumba classes in their programs (Zumba Fitness, 2012). Today, Virgin Active in Norwich offers an exclusive range of fitness classes including; body pump, body combat and step classes. Zumba features in their aerobic classes, and is fast growing in popularity says the Norwich Virgin Active Fitness Manager in an interview (see appendices). However despite the ever-growing popularity and widespread of Zumba, there is still very little documented research highlighting the potential fitness and health benefits of the dancing phenomenon. The author, a volunteer at Virgin Active agreed with fitness managers that determining the average exercise intensity and energy expenditure during a Zumba class could provide valuable information about the classes Virgin has to offer and a unique selling point. This project set out to determine the average exercise intensity and energy expenditure during a Zumba fitness class at Virgin Active. Literature review Melissa Napier conducted a case study, investigating if and how, Zumba fitness has impacted womens participation in Doon Valley Leisure Centre. The objectives were to source out the reasons and factors that were impacting female participation levels within physical activity. The research found that for a fitness centre in Dalmellington, the majority of Zumba participants were aged between 40-59 years. However these results were obtained from both Zumba and Aqua Zumba participants which supports evidence in the secondary research that Aqua fitness is popular and recommended to the elderly population. Zumba participants said they attend classes because they think Zumba is an enjoyable exercise and allows them to socialize whilst increasing their fitness. Section 2 of the questionnaire asked the Zumba participants what they think makes Zumba different and more appealing than other forms of exercise, 44% answered Fun. Other activities that the Zumba participants said they enjoy include: Aqua Zumba and swimming. For the non Zumba participants they said they preferred gym, swim and fitness classes other than Zumba. This is not surprising as 80% of non Zumba participants are members and all these services are accessible to them as they are included in the membe rship prices. Evidence in Secondary research shows that interest in sport declines with age however the investigators primary research shows that 53% of Zumba/Aqua Zumba participants are 40-59 years old with only 7% aged 16-24 years old. Although Zumba may not appeal to all, it is 16-24yrs with latent demand for more physical activity options according to the Active People Survey carried out by the Womens Sport and Fitness Foundation. The only other literature which examined the exercise intensity of Zumba was conducted at Adelphi University (Otto et al., 2011). It reported caloric expenditure during Zumba to be between 6.6 and 7.4 Kcalà ·min-1 depending on the particular dance style being performed. However there appears to be a wide range in the intensity of Zumba and other group fitness classes, depending upon the choreography and enthusiasm of the instructor. The enthusiasm of the instructor, as well as the experience of being in a group setting, often spills over to the participants, who then work harder. This cannot be captured when following video-taped workouts and the growing popularity of Zumba warrants additional research into this growing fitness trend. Methodology Twelve healthy female volunteers (20 à ± 1.5 years, 1.57 à ± 0.08 m, 61.9 à ± 22.6 kg) were selected from the Virgin Active fitness club in Norwich. All participants were regular exercisers and were relatively experienced at participating in Zumba fitness classes. Prior to participating in the research project, all subjects were asked to complete a PAR-Q and provide written informed consent. Participants completed a health history questionnaire to check for any contra-indications which would prevent them from participating, and were informed that they could withdraw from the study at any time, even after giving their written consent. The data produced from the study was kept confidential and the participants were able to access their particular data if requested. Prior to the Zumba class, each participant had to perform an incremental, maximal treadmill test in the Norwich City College sports laboratory. This test measured the participants heart rate (HR) and oxygen consumption (VO2). Test procedures can be found in appendices. From this test, an individual linear regression equation was developed for each subject to predict VO2 from HR. This equation was subsequently used to predict VO2 (mlà ·kg-1à ·min-1) during the Zumba session for that subject. Measurements of steady state oxygen uptake by the participants were used as an indirect method to measure energy expenditure (calorimetry). Energy expenditure was calculated from the predicted VO2 data assuming a constant of 5 Kcalà ·L-1 of O2 consumed. Similar studies had demonstrated that the HR-VO2 relationship during treadmill exercise accurately reflected the HR-VO2 relationship during Zumba. After treadmill testing, subjects were given a Zumba DVD and told to practice the routine at least three times prior to the class. Following the treadmill test, all participants took part in a Zumba session. The Zumba class was delivered by a fully qualified zumba instructor in a sports hall at Virgin Active. During the class, all participants wore a heart rate monitor which recorded all the data throughout the session. After the session, the data was inserted into the individuals HR-VO2 regression equation to estimate the VO2 and energy expenditure of the participant during the class. Sampling Participants were recruited from Virgin Active. Participants were found using a simple snowball sampling technique because of the social networks that existed between class members. Zumba enthusiasts were asked to recommend other appropriate people for the project. Data collection The research design relied heavily on numerical data, therefore the research project adopted a quantitative approach. Numerical data included heart rates, vO2 max data and Kcal data. The project used regression analysis to identify the relationship between exercise intensity and calorie expenditure. Data were analysed using the statistical package IBM SPSS, PC program, version 7.5 Data Analysis Physiological responses to the Zumba session can be found in Table 1. The average HR was 154 à ± 14 bpm, which corresponded to 79 à ± 7.0% of HRmax. The average estimated VO2 was 66 à ± 10.5% of VO2 max. The average estimated energy expenditure of participating in a Zumba session was 9.5 à ± 2.69 Kcalà ·min-1, which corresponded to an average of 369 à ± 108 Kcal per class. To improve cardiovascular fitness, ACSM recommends that apparently healthy adults should exercise between 64-94% of HRmax and 40-85% of VO2max (ACSM,à 2010). In order to control body weight, it is recommended individuals expend an average of 1500 or more kcal per week, which is 300 kcal per exercise session when exercising five times a week (ACSM,2010). Based upon the above recommendations, the Zumba class met ACSM guidelines for both parameters. Exercise intensity averaged 79% of HRmax and 66% of VO2max, respectively, and every subject fell within the recommended guidelines. Conclusions and recommendations Zumba is likely best suited for those who are already comfortable with fitness routines and with dance, as it could offer a pleasant change and participants would already know that they could keep up with dance fitness routine. However Zumba is also suitable for participants of all age and fitness levels. The intensity of the workout is relatively subjective so this means the participants can make the workout however hard or easy they would like depending on their enthusiasm and inhibitions. ACSM recommends that individuals should burn atleast 300 Kcals per workout in order to promote weight loss and maintain a healthy body composition (ACSM, 2010). This study concluded that participating in a Zumba dance class used an average of 369 Kcal for an average length class. It should be pointed out that average class length in the current study was approximately 39 minutes in length. Longer classes would obviously result in greater energy expenditure. Thus, regular participation in Zumba sh ould positively affect body composition. Future studies may want to focus on the physiological benefits following an 8-12 week Zumba training period. 1475 WORDS
Gender Discrimination At Workplace Sociology Essay
Gender Discrimination At Workplace Sociology Essay The reason to conduct this research is to gain knowledge and insight about various factors which results in Gender Discrimination and the problems and hurdles which women face in todays work environment. Two sectors mainly public and private were taken in an account in order to know that in which sector Gender Discrimination greatly take place. Important factors sought include: organizational climate, society and attitude. I would like to know the perception of both men and women on the above mentioned factors and that how these factors influences Gender Discrimination. The mean of research, which I adopted for my research are research paper study, interviews and questionnaires from both men and women. I segregated the selected population according to eight socio-economic classes: GENDER AGE INCOME OCCUPATION SECTOR EDUCATION STATUS ORGANIZATION Male 20-60 10,000-above Public and Private Graduate, masters, M.phil, Phd Single, Divorced, Married Female 20-60 10,000-above Public and Private Graduate, masters, M.phil, Phd Single, Divorced, Married I have found out variety of answers from questionnaires and interviews under different circumstances. ABSTRACT: This paper presents the major factors which greatly influence and result in the Gender Discrimination at work place. To find out that, I have floated fifty questionnaire (30 women and 20 men) in both private and public sector as well as took three interviews from both high management and font line staff ( 2 females and 1 male) in order to know different perception of people in different sectors about Gender Discrimination. Further more, this paper talks about the impact of organizational norms and culture on the female employees performance, comfort at job and perceived growth. This study is focused on governmental organization, private organization, educational institute and public private hospitals. It is concluded that, there is a Gender Discrimination at workplace and women are treated unfairly at their jobs as compared to men. But this discrimination is because of the society in which we live in and because of the different family laws and perception which people have due to dif ferent backgrounds. Also organizational climate as a whole dont effectively influence gender discrimination. Its influence is less then the other two factors which are society and attitude. INTRODUCTION: In an age where we talk about equal rights for men and women, there are still occurrences of people being discriminated against because of their gender. Gender discrimination is not an issue, which one can ignore or tolerate silently. People should realize that gender discrimination at workplace is a serious form of employment discrimination, which should not be discharged. Gender based discrimination is defined as undesirable action or differential treatment against a person that would not have occurred if the person had been of another sex. Gender discrimination is considered as a serious form of injustice and is illegal in certain circumstances in most of the countries around the world. There is a need to develop organizational culture compatible to societal values that supports and motivates more women to participate in the economic and national development activities. There is a challenging task for the organization in future to retain and welcome the rapidly increasing womens participation in the work force both in public and private sector. . BACKGROUND INFORMATION: While some bias is open and overt, much more of it is hidden. We all have hidden biases about particular groups, places, and things. Hidden bias stems from our everyday sense of the way things are, which informs our everyday workplace interactions. Bias affects what we notice about people, how we interpret their behavior and what we remember about them. We tend to notice, interpret and remember behavior that reinforces our biases. These assumptions are pervasive: both men and women make them. The biases that result affect our interactions both with people we know and with people we dont know. Gender bias, specifically, is our assumptions about the characteristics of men and women. For example, men generally are assumed to be aggressive, reliable, and competent and committed to their careers. Every day each one of us makes small judgments about individuals based on everyday assumptions that arise automatically. Research has shown that men benefit more from their accomplishments than women, and even small inequity accumulate over time and cause women to advance at a slower rate then men. The following are the most common patterns of gender bias encountered in the workplace. Maternal wall The strongest and most explicit bias in todays workplace is against mothers. Generally, maternal wall bias is generating when motherhood becomes salient or obvious to managers and colleagues. This typically occurs when a woman announces that she is pregnant, returns from maternity leave, or adopts a part-time or flexible schedule. Maternal wall bias stems from assumptions that mothers are not as competent as others, are not as committed to their jobs, and belongs at home because they cant be both good mothers and good workers. Competency The truth of the common saying women must try twice as hard to achieve half as much is documented by more than a quarter century of social science. Women need to provide more evidence of job-related skills than their male counterparts before they are viewed as competent. Additionally, women are allowed fewer mistakes than men before they are judged incompetent. Role Reversal Behavior that is acceptable in men often is considered unacceptable in women. A woman in a traditionally masculine job may be called hard to work with or too ambitious for the same behavior that helps a man establish himself as assertive and having leadership potential. The unspoken view in such situations is that women should be helpful, warm, understanding, and kind. In some workplaces, women are seen either as likable, dependentà ¢Ã¢â ¬Ã ¦traditional women who are nice but incompetent or as dominant, nontraditional women who are competent, but are disliked for violating unspoken norms that women should be inclusive and nurturing. The Gender Wars Workplaces create conflict among women when they evince approval of women who adhere to traditional feminine stereotypes (passive, nurturing, and allowing male supervisors to take the spotlight), but disapproval for women who buck such stereotypes. The most common workplace conflict among women is the generational conflict between older women who made it to the highest levels in their companies by closely following a traditional masculine career path and younger women who seek more flexible options, including part-time work. Because most gender bias is subtle rather than overt, policies and procedures that appear to be a facially neutral, objective, and job-related may be applied in ways that lead to fewer hiring and promotion opportunities, lower compensation, poor performance evaluations, more frequent disciplinary actions, and greater termination rates among women. These patterns result when managers base their employment decisions on biases rather than job performance. Decisions based on bias rather than legal job related reasons often will end up penalizing talented workers and rewarding less talented ones. As a result, such decisions may well expose productivity and negatively affect employee morale. In our research I have first begin by identifying gender bias, focusing on public and private sectors and then comparing and contrasting the working environments in both corporate cultures, and then analyzing how rampant gender bias against women is, in both scenarios. RESEARCH INTREST: This research is being conduct to know what the level of gender discrimination at work place. What problems are arising due to gender biasness and what are the consequences of this? How is it affecting the society, peoples life and business world? And the main reasons which lead to gender discrimination at work place. SIGNIFICANCE OF STUDY: I have conducted this research in order to know that to what extent there is a gender bias at workplace. What are the reasons and what problems are created due to this gender discrimination at work place? Through this research we can come up with the solution to the problem of gender discrimination. Also this can help to make people aware of this prevailing problem of gender biases and the reasons of its occurrence. And the negatives and positive affect of this on the business world and personal lives of men/women. OBJECTIVE OF THE STUDY: The objective of this study is to Study gender bias in the workplace and focus on the distinction made between a man and woman in a working environment on the basis of professionalism, integrity, and respect, and gauging whether this phenomena has decreased with the passage of time and awareness, or if it has become worse. Study the problems which female employees go through in their job due to society, family pressure and work environment. Study that in which sector, discrimination mainly exists. LITERATURE REVIEW: Sex Discrimination in Hiring: The Influence of Organizational Climate and Need for Approval on Decision Making Katz (1987) conducted a research to find out that whether the organizational climate affects the hiring and decision making or not. He conducted an experiment in Northeastern University. One hundred and sixty males were taken as a sample of age 24- 25 years. He created two artificial organizational environments i.e. discriminatory and non-discriminatory. All the participants were divided into two and were given job descriptions of the organization along with resumes of both males and females. They were also given a scale on which they have to arrange their rà ©sumà ©s. That scale has four variables hiring, salary, fit and longevity. The participants who were taking part in that experiment had to act as a manger and take decisions accordingly. The result which was extracted from the study was that men were given high priority and value in discriminatory organization on hiring, salary, fit and longevity.Whereas, male and female both enjoy equal rights in non-discriminatory environment. The finding of the above mentioned research was all hypothetical and has internal validity. The participants who took part in the experiment were asked to imagine that they are mangers which can result in the real life findings. Sex discriminatio n is an on going process in today society and has to eliminate from a real life experiment which should have external validity and whose findings can be applied in further studies. Sexual Harassment at Workplace: Phillis (2000) in her research paper has reviewed three court cases studies on the respective topic sexual harassment at workplace. She, in her research with the reference of the court case studies wants to find out different forms and effects of sexual harassment women faces at their workplace. The court case study shows that the women are treated very badly at their workplace. They are asked for the physical favors as well as men find different ways and excuses to physically touch them. Females at their workplace are also exposed with bad sexual jokes and pictures which not make them uncomfortable while working but also have bad psychological effects on their minds which ultimately results in the choice between their job and security. Sexual harassment is a very serious problem which still practiced in todays society, government should laws and policies which prohibit this act in an organization. Sexual Harassment at Workplace: Experience of Women at Health Sectors Chaudhuri (2006) conducted a research to investigate the perspective of sexual harassment at health sector. For her research, she has done exploratory research and has under taken four hospitals, two governments and two private. The entire research was qualitative as this issue is quite sensitive. One hundred and forty one women employees take part in this research of age around 20-59. Three group interviews, forty informal interviews and one hundred and thirty five in-depth interviews ere taken from the participants of both public and private hospitals and from that it has been observed that females employees are not only experience verbal and psychological harassment but also male employees touch them physically. Mostly nurses and junior doctors experience sexual harassment. Complaints by them were not given any value and importance and hence no actions were taken against sexual harassment which shows the power disparity among men and women. No proper laws are made in this sector w hich eventually results in the fear and insecurity in the mind of females. Salary Structure Effects and Gender Pay Gap in Academia Barbezat and Hughes (2005) based their study of gender salary gap and discrimination on The National Faculty Survey Data (1999). National Faulty Survey conducted their research by taking in account nine hundred and sixty institutions both public and private of fifty different states and two thousand five hundred and seventy six full and part time employees both males and females associated with these institutions. Authors basic aim was to find out the salary gap between males and females who have similar responsibilities and work positions. From the survey, it has been concluded that men earns 20.7% more than that of women of the same post and responsibilities. The percentage is high at the professional institutions as compared to the art institutions. Men also enjoy more benefits and compensation then women. This issue has to be eliminated and need to be studied more. Gender Discrimination at the Labor Market Lissenburgh (2001) in his paper uses National Survey Data and Human Capital Theory to find out the degree and gender discrimination at the UK labor market (1990s). From the data of the National Survey, the part time female employees faces lot of salary and benefit issues as compared to full time female employees. According to the Human Capital Theory education, training and experience play a great impact on pay gap. There will be an increase of 10% in the women pays only if they pay more attention to the human capital factors. This is also one of the reason, part time female employees get less salary as compared to full time. Government should make such policies which should bound companies to pay all men and women equal pays. Determinate of Gender Based Wage Discrimination in Pakistan: a Confirmatory Factor Analysis Approach Yasin et.al(2010) conducted an empirical study to find out the two main points that wage difference among men and women and development in labor market (1999-2008) Pakistan while keeping socio-culture and individual factors in consideration. All the data and information was collected from secondary source mainly from Labor Force Survey [(2007-2008) conducted by Federal Bureau of Statistics], ministry of industry report. The sample which the Labor Force survey under took for their survey was eighteen thousand nine hundred and twelve household one million individuals from all the four provinces of Pakistan between the ages of 14-65 years. These samples contain both upper and lower level of employees. The results from the survey and from all the reports was that with the passage of time gender discrimination is increasing and the reason behind this is the level of education, experience and organization culture. They also show that gender discrimination mostly apply to those women who are married and have children because then ultimately they have to give more time to their family and children and less to their work. Also our society doesnt allow married women to work 9-5 job. Gender discrimination is an ongoing process and has to be eliminated for the better economic growth of the country. Government should make certa in policies which results in reduction of discrimination. Gender earning inequality and discrimination in Pakistani Labor Market Farooq in his research paper estimate the monthly wage/earning difference between men and women in Pakistani labor market on the findings of Pakistan Standard and Labor Market (PSLM) Survey (2004-2005). The purpose for which this survey was used to find out the Human and non-capital factors for the wage difference in Pakistan. This survey has all the relevant information needed to find out the gender pay gap. The sample which was used in the survey had ninety one thousand three hundred and nineteen household both males and females out of which 51.6% were males of mean age 36 and 48.4% were females of mean age 32. The results which was carried out by author with the help of PSLM survey was that the gender pay gap is increasing and the reason behind that is education and experience of females. Also he found out that males enjoy more benefits and incentives than females. An Analysis of Occupational Choice in Pakistan: a multinomial Approach Nasir (2005) conducted his research on the data of Pakistan Integrated Household Survey [PIHS (2001-2002)] and multinomial log model of occupation choice for males and females to find out the occupational structure and how different factors, human and individual factors, help individuals to choose their occupation. The sample of Pakistan Integrated Household Survey which was conducted by Federal Bureau of statistics was fourteen thousands eight hundred and twenty five house hold which was divided in to two categories that are regular wages and salaries worker and second was self employed and employer. One more sample which was taken by them was thirteen thousand seven hundred and ninety three individuals out of which eleven thousand five hundred and seventy three were males and tow thousand two hundred and twenty were females of ages 10-65. The information which was important for this sample was age, earning, marital status, occupation and education. From this survey and multinomial log model of occupation, the results which were carried out were that education play significant role in choosing the job. Men choose that job which pay good salary and give them more benefits. They mainly choose job on human capital factors rather than on human factors. Author also states that, there are certain factors which play great and important role while choosing of occupation but if there were no factors than there will be an efficiency in the economic growth and women will get chance to come in front to the market with their talents and skills. Occupational segregation results in lowering of the wages and benefits of female employees. Human capital factors (education, experience and training) play a significant role in choosing jobs. Occupational choice greatly impact women as they have to look for their family and children and because of that they have less opportunities then men. To eliminate this concept more job types for women have to open and also there should be equ ality in work place and married women should be given certain benefits so that they can manage their time and work both. As education is one of an important factor therefore women education should be promoted. Organizational Culture: Impact on Female Employees Job Performance Irfan et.al (2009) conducted a research to find out the impact of organizational culture and environment on the performance of female employee. According to author, organization should develop such environment which allows women to work comfortably and attractively and has to be free from biasness. He conducted a research in three services sectors i.e. education sector, banking sector and information technology sector. Stratified random sampling was used. Three hundred females were sampled, hundred from each sector. One hundred and seven questionnaires were distributed among them asking the question on how much organization culture has impact on female employee performance. The results which were extracted from the research were that organizational environment play an important role on the performance of female employment. Organizational environment can make the work place attractive and supportive. Also not only organizational environment but attitude of peers, work environment and support from the family also play a significant role on the female performance. Discrimination in the Health Care Industry: a Research on Public Hospital Ozcan et.al (2011) conducted a research to find out a discriminatory behavior in public hospitals and the reasons and way through which this behavior can be reduced. He conducted a research in public hospitals by distributing questionnaires among three hundred fifty one health care employees and by taking semi-structured interviews from five health care employees from each hospital. The result which was extracted from the research was that there are three types of discrimination mainly ideology, vocational and gender discrimination. Ideological and vocational discrimination mainly results from political and professional views whereas gender discrimination mainly occurs at piratical society where there is male dominance and they enjoy every benefits and advantage of life. Also gender discrimination take place because of societal and cultural factors which prohibits women to work outside and should take care of her home. Discrimination whether it is ideological, vocational or gender sh ould be eliminated in order to increase the economics growth and give platform to females to show their talents. THEORITICAL FRAMEWORK: Gender discrimination at work place Society Organizational climate Attitude Hiring Bias managerial decisions Salary Benefits Promotion Religion Culture Family law Social stigmata Women education Peer pressure Maternal wall Male dominance Mental capabilities Physical strength of women INDEPENTANT AND DEPENTANT VARIABLES: Dependant: gender discrimination at work place Independent: organizational climate, society and attitude. OPERATIONAL DEFINATION: Organizational climate: Organizational climate is the process of measure the culture of an organization. It is a set of properties of the work environment, perceived directly or indirectly by the employees, that is assumed to be a major force in influencing employee behavior. I have taken it as an independent variable as it directly results in gender discrimination at work place. Organizational climate have a great impact when hiring new employees or when setting their salaries or when giving them benefits. Also managers play a great role in an organization as in male dominating organization manager usually does bias decision with regards to women. This result in Dissatisfaction of women in working environment Large number of problems faced by women in an organization Less benefits given to women in an organization Mental stress Less importance and value given to women work and decisions Society: The norms and expectations a community has regarding a women role in society as a home worker. Society is also taken as an independent variable as it directly results in gender discrimination at work place. It is social stigmata that in Pakistan, working women are taken and seen in a bad way also women are not allowed to work outside their homes as it has been taken against their family law. Also religion is one of the factor which stop women to work outside their house. Women are given less importance in our society as well as there is a great discrimination in families to. Girls are given less value and importance in some families which ultimately effect their education and results in less experienced and educated women. Culture also plays a significant role in gender discrimination. This result in Less economic growth Less talent pool Less opportunities for women Attitude: Attitudes are probably one of the most important independent variables that lead to gender discrimination at the workplace. Peer pressure, male dominance all play a significant part in women feeling under pressure at the workplace. Their colleagues may act cold, or not deem them capable enough to handle projects and tasks that are essential to professional growth. Mothers, especially, are highly discriminated against, because of the reason that a mother will not be devoting full attention and focus to her work, instead she will be more focused on her children; hence they should not be hired, because it will cost the company. Also it is believed that women are physically and mentally less strong and capable then men. This result in Sexual harassment Less opportunists for married women Gender Discrimination: biases against women in terms of organizational decision. It encompasses salary, hiring, promotion etc. RESEARCH QUESTIONS: Relationship between organizational climate and gender discrimination, and how it affects the performance, salary, benefits and recruitment of women. How society, prohibits women to work outside and affect their personal and professional lives and result in gender discrimination? How women works and treated in male dominated society and how peer pressure effect women professional life? HYPOTHESIS: H1: culture in an organization is a cause of gender discrimination at workplace. Ho: culture in an organization is not a cause of gender discrimination at workplace. H2: society is a factor effecting gender discrimination at workplace. Ho: society is not a factor effecting gender discrimination at workplace. H3: attitude does results in gender discrimination at workplace. Ho: attitude doesnt results in gender discrimination at workplace. RESEARCH METHODOLOGY: Type of research: I have done both primary and secondary research. Primary Research: Primary research is very important as it give different perspective of people on one single issue thats gender discrimination at workplace in my case. I have interviewed from senior executives of organizations and frontline employees. Then I had also distributing questionnaires among the employees of selected organization to know the further information they have regarding the topic. Secondary Research: Secondary research is also very important as it give the supporting knowledge about respective topic and also help one to correct what has been done wrong previously. For secondary research I have taken in account ten published research papers of scholars which help me to find respective independent variables with I have used for both my interview and questionnaires questions. The research paper which I have taken mostly have either research done by scholars by them selves or they have base their research or theories or research done by special departments like world statistic bureau and world census bureau. Tool of Research: The tools of research which I have taken in account for my research paper are as follows: Research paper study: Different research papers written and published by different scholars are taken in account. From reading these papers I have also taken out important independent variables which help me to formulate my primary research. Questionnaires: Questionnaire is also one of the research tools for my researches which give me the approximate ratio of the different thinking of people both men and women. The type of scales which I have used in my questionnaires are as follows: Simple attitude rating: it is the most simple form of scale in which either respondent agrees or disagree with the question. Like YES or NO Category scale: it is a kind of scale which provide respondent different category of responses with alternative rating. Like NEVER, RARELY, SOMETIMES, OFTEN. Likert scale: this is a form of rating scale which allows respondents to indicate that how strongly they agree or disagree with any statement. Like STRONGLY DISAGREE à ¢Ã¢â ¬Ã ¦Ã ¢Ã¢â ¬Ã ¦Ã ¢Ã¢â ¬Ã ¦Ã ¢Ã¢â ¬Ã ¦Ã ¢Ã¢â ¬Ã ¦STRONGLY AGREE. Interviews: interviews will help me to get spontaneous and quick feed back from both executive level and frontline level employees. The types of interviews which I have taken are personal interviews, they are the one in which face to face questions has been asked. The questions are both in formal and in formal way. Target Population: Questionnaires: I have circulated fifty questionnaires among the employees of an organization. Out of sixty, thirty has been filed by women and twenty by men. The target population which I have selected is both from public and private sectors. Interviews: I have interviewed from the senior and frontline managers of an organization. The totally interview which I will be conducting will be three in number. Two form senior manager and one from frontline staff. Sampling: The type of sampling which I have used for my research is QUOTA SAMPLING; this is a non probability sampling procedure that ensures that the population which has been selected has some common features which researcher wants. I have used this type of sampling because I will be only taking interviews of those people and making my questionnaire filled from those people who are working in a particular organization. Interviews: I had taken three interviews, two from senior management and one from frontline staff. Ages ranges from 28-60. Two senior management are from SMEDA and BYCO PETROLEUM out of which one is male and one is female. Where as, I have interviewed women (front line staff) from PASSCO. For respondents responses look at appendix 2. Questionnaires: I had circulated fifty questionnaires, thirty from female employees ages ranges from 25-45 and twenty from male employees ages ranges from 25-60. All the participants whom I selected were from private (byco petroleum, LACAS and surgemaid) and public (PASSCO, SMEDA, CMH and Garrison school). For questionnaire look at appendix 1. STATISTICAL ANALYSIS OF DATA: I floated fifty questionnaires among fifty respondents, out of which thirty were female employees and twenty were male employees. I floated my questionnaires both in public and private sector. I did multiple regression using stat graphics on the data which I collected from the questionnaires. Multiple regression analysis includes any techniques for modeling and analyzing several variables, when the focus is on the relationship between a dependent variable and one or more independent variables. More specifically, regression analysis helps one understand how the typical value of the dependent variable changes when any one of the independent variables is varied, while the other independent variables are held fixed. The results which I computed from regression are as follows: The above are the values which are commuted from multiple regression. Dependant variable in the above table is gender discrimination where as the independent variables are attitude, organizational climat
Saturday, July 20, 2019
Isolation in Bartleby :: essays research papers
Roles of the Sexes The submissive role of the female in a marriage or relationship is a common problem in many societies, including our own American society. This role has become so common that in fact it is now expected of the female. This male dominance goes as far back as the human race, to the beginning of relationships and marriage between the female and the male. Then, the physical prowess of the male led to his dominance in all situations and thus formed these roles. Even presently, with all our advances in equal rights and womenââ¬â¢sââ¬â¢ advances in the work fields, this role of submission and passivity is still present among our society. Why do women accept this role? Why hasnââ¬â¢t it banished with the right to vote and her expansion into the male-dominated workplace? These roles are inbred into our society. The men are raised to lead and take charge. Women, on the other hand, are taught that their place is to keep peace, and in most scenarios that means conform ing. There are many reasons women accept or allow this role. For many women, they find safety in allowing the male to dominate the relationship. The submissive role is familiar or so expected that the women fear changing the situation. Many authors illustrate this role of the sexes and portray some reasons and situations that are common in our society, such as Sidonie-Gabrielle Colette, in her story ââ¬Å"The Handâ⬠, and James Joyce, in ââ¬Å"Evelineâ⬠. These two authors both, even though each describes a woman in a very different, yet remarkably similar, situation, discuss one of the major reasons women succumb to males. Colette was a significant feminist in the early 1900ââ¬â¢s when the womenââ¬â¢s right movement was in full swing. She fought for equal opportunities for women and proved it was possible when she was the first woman to be admitted to the Goncourt Academy. As a novelist, she used her writing to illustrate the assumed roles society has developed. The Compact Bedford Introduction to Literature remarks, ââ¬Å"Her professional life and three marriages helped to shape her keen insights into modern love and womenââ¬â¢s lives.â⬠(Compact Bedford, 196). Colette understood the expected submission role because she had lived the role of the wife several times. Also, as one of the few women in the workplace, she was subjected to even more male supremacy. She could write about the reasons why women comply because she understood and had been a victim herself.
Friday, July 19, 2019
Essay --
This Ocean energy is found around the world. 70% of the oceans surface is covered in water. According to alternative-energy-news website ââ¬Å"Ocean energy is recovered when the wave power farm operates on the wave energy that is created when a float/ buoy flows with the natural movement of the waves.â⬠The equipment needed is a very big buoyant crafted buoy, a long reliable cable wire and a heavy weight so the buoy does not float away and ruin your research. ââ¬Å"The concept is simpleâ⬠, says John Lienhard, a University of Houston mechanical engineering professor: ââ¬Å"Every day the moonââ¬â¢s gravitational pull lifts countless tons of water up into, say, the East River or the Bay of Fundy. When that water flows back out to sea, its energy dissipates and, if we donââ¬â¢t use it, itââ¬â¢s simply spent.â⬠The stronger the waves the more energy can be taken from it to power our world. We as humans use and waste this energy doing everyday work. Yes, you do need special equipment for processing wave energy from the ocean, main thing you need is a buoyant buoy to throw into the ocean and weigh it down with one solid weight, so you donââ¬â¢t lose almost 3 million dollars. Our energy sources is formed when the tidal energy is produced through the use of generators in the ocean. The generators are large under water turbines that are placed in areas with the highest tidal energy.The turbinesââ¬â¢ job is to take in the kinetic motion of the withdraw and flow of the ocean's tides (shallow water) to get electricity. The tidal turbines are best used for shallow waters, because it is stronger than and most stable than casting it into the ocean where you would have to check on it everyday in almost deadly weather. They help because turbines rotates slowly so ships and passing ani... ...ards fuel and on going operation that represent upwards of 80% of the plantââ¬â¢s cost of energy. The greater availability of wave energy in areas means that devices will be able to absorb more energy and convert that to power at a greater rate that devices in areas with low wave energy density. Ocean power technologies will to live initially in areas with wave energy density.â⬠As you read this excerpt from the website what are your opinions. Early-stage prototype government backed funding. We can conserve ocean energy by not polluting the ocean, save energy (use less lights and electricity). We can also conserve other natural energies. Ways to conserve energy would be: walking, biking, carpooling, using the mass transit. You can turn your refrigerator down, wash clothes in warm or cold water, turn down water heater, and the big thing we can do is Reduce, Reuse, Recycle.
Thursday, July 18, 2019
Ophelias Hamlet :: essays research papers
Hamletââ¬â¢s Ophelia William Shakespeare has written many masterpiece plays and has told a vital story in almost all of them. In the play Hamlet Shakespeare uses melancholy, grief, and madness to pervade the works of a great play. Throughout the play Shakespeare uses such emotional malady within Hamlet, that the audience not only sympathizes with the tragic prince Hamlet, but to provide the very complexities necessary in understanding the tragedy of his lady Ophelia as well. It is the poor Ophelia who suffers at her lover's discretion. Hamlet provides his own self-torture and does fall victim to melancholia and grief, however his madness is feigned. Ophelia and Hamlet each share a common connection: the loss of a parental figure. Hamlet loses his father as a result of a horrible murder, as does Ophelia. Her situation is more severe because it is her lover who murders her father and all of her hopes for her future as well. When looking at her character, one would think she was in grief but quickly turns to madness. Ophelia is made to be this sweet innocent girl but then turns crazy after her father dies and Hamlet leaves for England. People argue that Hamlet has the first reason to be hurt by Ophelia because she follows her father's admonitions regarding Hamlet and his true intentions for their love. Polonius tells Ophelia that Hamlet will not do anything but be fickle with the girls since he is suppose to have an arranged marriage. After telling Ophelia this, Polonius and Claudius try to have Ophelia become bait to find out why Hamlet us acting crazy. Hamlet begins with his overwhelming sarcasm toward Ophelia, "I humbly thank you, well, well, well," he says to her regarding her initial pleasantries (3.1.91). Before this scene, he has heard the King and Polonius establishing a plan to deduce his unusual and grief-stricken behavior. Hamlet is well aware that this plan merely uses Ophelia as a tool, and as such, she does not have much option of refusing without angering not only her busybody father but the conniving King Claudius as well. Hamlet readily refuses that he cared for her. He tells her and all of his uninvited listeners, "No, not I, I never gave you aught" (3.1.94-95). Hamlet has a right to direct his anger to Ophelia because it was her that ââ¬Å"repelledâ⬠against him. Her father forced her, and if she did try to disobey her father she could be disowned.
ABC Chemicals Essay
aft(prenominal) information the scenario about ABC Chemicals it was obvious that at that place were several appargonnt endangerments and ventures that I rophy which necessitate to be assessed and e truly eliminated or applyled. These bathroom be achieved using divers(prenominal) Legislative measures and Codes Of Practice(COP) which is relevant to their Industry. By facial expression further into the chemics that ABC handle we foundationnister assess the presentable jeopardizes Solvent nigh re solvings be either flammable or highly flammable, this is dependent on their volatility. When a mixture of vapour and air aggregate in that location is a possibility of an explosion. The megrims from solvent is denser that air, it sinks to the bottom of the container. Vapours female genital organ still be found in void containers and pose threat of realizable fire, hence empty containers should be stored unmannerly and peak fasten. in that location argon much volta ge wholesomeness finds ca handling by solvent including nephrotoxicity to the nervous system, liver and kidney molest, respiratory issues to name a few. It burns with an covert flame making it harder to extinguish. acerbics corrosives have the capacity to destroy other substances when in contact. It causes chemic burn when in contact. PPE should be bony including Gloves, caoutchouc Goggles, Protective Apron, arctic Shoes, and a Face Guard. Workers should always consult a SDS relating to the corrosive substance prior to use.Corrosive substances and mixtures class 8 perilous goods can be either saltlike or blistering and these two categories are incompatible. Risks associated with repositing and treatment of corrosive substances and mixtures can be eliminated or minimised by observing the guidance on Worksafe Australia National Code of Practice for the terminal and discussion of Workplace stern Goods sum-lotion and condom showers should be readily complaisant where corrosives are handled or transferred.Acid paneling comes in as a water supply treatment chemic substance. It should non be stored with detergents or solutions. Acids should never be stored with alkaline chemical substances cod to the potential for harmful chemical reactions. Some reactions of acids and alkaline chemicals can be highly heat-releasing and rapidly generate large hearts of gas, do an explosion put on the line. Chemicals such(prenominal) as acids can cause respiratory illnesses, cancers or dermatitis. WHS ordination 2011(357 containing and managing moves)(359 Fire control)(360-362 necessity Equipment, Emergency Plans, Safety Equipment) (363-control of jeopardizes from storage or use systems & regulation) (331 SDSs)(60- managing risks to health and gum elastic) manual handlingThe WHS Act pass ons a framework to protect the Health, preventative and eudaimonia of all(a) workers at work and that of slew who may be affected by the work carried out. The WHS Act aims to *Protect the health and arctic of workers and other people by eliminating or minimising risks arising from work or workplaces * discover fair and effective representation, consultation and cooperation to citation and resolve some(prenominal) health and safety issues in the workplace *Encourage employer organisations and workers Unions to undertake a constructive role in improving work health and safety practices *Assisting businesses and workers to achieve a healthier and safer workings environment *Promote information, education and envisionning on work health and safety * turn in effective compliance and enforcement measures, and * pose continuous improvement and progressively high standards of work healthWorksafe Australia has devised the National stupefy Work Health and Safety (WHS) Regulations. A new system of Chemical compartmentalisation and accident communication on Labels and Safety selective information Sheets (SDSs) establish on globally Ha rmonised system of Classification and labelling of chemicals (GHS) pass on come into affect. in that respect will be a five (5) year transitional period for moving to the new GHS based system, this will allow the two varied systems to be used together .After 31 December 2016, (the end of the 5 year period) all workplace chemicals must(prenominal) be classified using the GHS system, Labels and safety data sheets (SDS) must also be updated.. The WHS Regulations include duties for a Person conducting or Undertaking a business to mete out any risk to Health and safety that can be caused from the Handling, Storing and Generating of Hazardous chemicals in the workplace. These Duties include tasks such as, but non limited to *The correct labelling of Containers*Displaying Safety Signs*Maintaining a Register And Manifest (if relevant) Of the furious Chemicals and providing Notifications to the regulator of the Manifest Quantities *Ensuring that exposure standards are not exceeded.*th e cookery of Training, information, instruction and supervision to all employees *identifying risk of physical/chemical reaction of imagineous chemicals and to delay the stability of these chemicals *provision of spill containment system for bumpous chemicals if needed *obtaining up to date Safety info Sheets (SDS) from the manufacturer, importer, supplier of that chemical. *Controlling ignition sources and accumulation of flammable and combustible substances. *Provision and availableness of fire protection, fire chip equipment and speck/safety equipment. *preparing an compulsion curriculum if the measurement of a incidentous class chemical exceeds the manifest quantity for the chemical * secure the stability & support containers for bulk hazardous chemicals including Pipe-work and any attachments. *De-commisioning of underground storage and handling system* spread abroading the regulator as currently as mathematical of any chuck out tanks More information regarding H azards and risks associated with the use, generating, storing and handling of a hazardous chemical can be obtained from the following resources - concomitant reports-Australian Code for Transport of Dangerous Good by Road & plain-National Industrial Chemical Substances Information organisation (NICNAS) The Regulatory Authorities-WHS Consultant-Trade unions-Employer Associations-By prying the internet, such as Safework Australia, the Australian regime webpages as well as umteen other sites relevant to your industry.Hazards*When spillage occurred, it states that it was cleaned up with a rag then dumped into a normal ache dumpster which was emptied on a weekly basis. The disposal of these rags in the general dumpster poses a major risk of gravel contamination with other rags that have had been used with other chemical/substances, which could lead to a toxic/hazardous situation, the production of toxic gases and the potential of a fire hazard. There is also no cite of any PPE be ing used during the handling of the chemicals either * Chemical storage in that location are several different types of chemicals stored at the facility, there is a risk if stored together that they can cause either a chemical or physical risk, *Another hazard I noted was that ABC chemicals grammatical construction only had a limited amount of urgency equipment, with the amount of employees working for ABC this definitely causes a hazard, there obviously is not generous equipment available to accommodate more than a handful of workers.The lodge could end up in legal strife for not supplying the correct amount of Emergency Equipment as set out in the WHS Regulation 2011 *Manual Handling Hazard the drums are 205 Ltrs, they are then decanted into containers approximately 30 ltrs/Kilo ,there is no mention of grant equipment to move these containers. *The Storing the empty drums in the rear of the yard against a cyclone fence, these drums are sitting for a whole month before bei ng removed.Even though these drums are presumably empty, drums that have had solvent in them, unless stored open and upside down pose a major risk of explosion causing fire, with an un-kept paddock directly tail end the fence where these drums are stored there is the potential for the fire to spread causing footing and risk to the public also. *The lack of employee cookery in relation to Safe Handling Of Chemicals (hazardous substances) or how to deal with Emergencies. . No employees have be appointed as safety officers (section 19 of the Act), if there was an incident there would be no neaten direction to follow..*Location There is risk to not only to employees of ABC there is also risk to all at the child lot centre, the nursing home, as well as the general public with the building being located on a busy street which is prone to accidents. * escape of Emergency plan displayed. No arrest plan displayed to direct people when there is an incident These risks can be assessed by several means such as SDS (Safety Data Sheets), independent Audit, Employee participation, hazard studies.level of risk and ControlSmall chemical spills- (dependent on the severity)- first aid defect is likely due to chemical burn(dependent on skin sensitivity, defacement could range from kid-major) richly Risk- Have a assort stadium for decanting distributively separate chemical. Provide spill containment system, Provide appropriate schooling in the control of spills, cook procedure for the control of spills Provide appropriate PPE for each particularized chemicalDisposal of Chemical Rags minor fatal injuries is very likely from this dangerous practice which is exposing the risk to the disposal company provide and driver utmost(a) risk- Notify Supervisor/ HSR- Provide spill containment system, Provide controlled waste system, have a separate waste area for specific chemicals. ensnare up a controlled collection of wasteStaff pretermiting Training in handling chemica ls minor fatality possible perfect risk-Immediate action required, notify executive programy program/HSR. Adopt a training plan to up skill the workforce in line with legislative requirements. realize the training covers areas such as* How to understand SDS Data Sheets* Personal Safety* Emergency procedures* deduction training & Ongoing training circumscribed Emergency Equipment major hurt is very likely through to fatality extreme risk- immediate action required, notify supervisor/HSR. Undertake risk assessment with workers and emergency services to determine all main(prenominal) risks. Review SDS to identify risks Implement spare emergency equipment as required, an example of such equipment could be * Spill containment systems * Emergency showers and eye wash stations * Monitors and alarms *Fire fighting equipmentStorage of chemical drums Major- fatality fundamental risk- separation of the different chemicals in storage areas to minimise the risk of interaction. tick the glide by displaying of SDS information for each of chemicalsStorage of empty chemical drums- Major FatalityExtreme Risk- Organise that the collection of empty drums are done more frequently (eg Weekly) Ensure Solvent drums are turned upside down with lid open to reduce risk of gas build up. Ensure each chemicals drums are stored separate to each other to minimise interactionLack of emergency Plan displayed- Minor- FatalityExtreme risk- consultation within the workplace, and surrounding Businesses. Develop a emergency plan including things such as evacuation procedures Notification Procedures ( advising emergency services medical treatment dialogue procedures between co-ordinater of the emergency response and everyone at the workplace. The plan is to be explained to all actual staff, and included in inductions for future staff. The plan needs to be displayed in a location that is accessible to all staff of the workplace. The plan will be reviewed at acceptable intervals no more than 5yrs to ensure its effectiveness or when there is a change warranting an update.Manual Handling- Minor- Major There is no mention of Lifting devices meaning injury is then Extreme Risk. Ensure adequate training of workers in regard to square-toed Manual handling. Ensure there is appropriate lifting devices for employees to use to minimise the risk of injuryLocation- Minor Fatality. Due to proximity to day-care and nursing home and the fact it is on a busy rd which is prone to accidents there is a Extreme risk- the installation of safety barriers well-nigh ABC Chemicals to minimise the risk of damage caused by motor vehicle accident, set up exclusion zone for storage of any chemicals. Consultation with the aged care facility and the surrounding Businesses regarding ABCs emergency Plan in reference of incidentRisk Controls1.Eliminate a hazard, removing the hazard totally, Eg repairing damaged equipment immediately. If this is not reasonably operational the next step is to minimise the risks so cold as is reasonably workable by doing one ormore of the following2.Substituting (wholly or partly) the hazard creating the risk with something that has lesser risk, Eg instead of using a lead based product, use a non lead based one3.Engineering controls/. Isolation- the hazard from any person exposed to it, with use of Barriers etc, lifting devices for manual handling4. Administrative controls. Training, provide manuals regarding H&S in the workplace,redesigning the clientele task. If the risk is still present, the remaining risk must be minimised, so far as is reasonably practicable,5.PPE. such as Gloves, Safety Goggles etc A combine of controls should be used if a adept control is not sufficient for the purpose. PPE is a last resort because it protects the person against the hazard but it does not remove the hazard
Subscribe to:
Comments (Atom)